 |
EPIC home
|
Show all experiments for ceh-41
|
Back to previous page
|
Details for experimental series: 20080808_ceh-41_2_L1; gene: ceh-41 |
experiment details |
strain details |
construct details |
full-size tree |
full-size movie |
download annotations for this experiment |
Experiment details:
Series |
20080808_ceh-41_2_L1 |
Date |
8/8/08 |
Person |
JIM |
Strain |
RW10585 |
Treatments |
None |
Gene Assayed |
ceh-41 |
Type of Construct |
Promoter Fusion |
Imaged Timepoints |
255 |
Edited Timepoints |
135 |
Edited Cells |
385 |
comments
|
asymmetric in C/D (Dp!) /MS muscle, AB subset |
Edited By |
JIM |
return to top of series: 20080808_ceh-41_2_L1
|
Strain details:
Strain Name |
RW10585 |
Date Created |
8/25/08 |
Source of Genotype |
ceh-41::H1-Wcherry |
Reporter Allele |
stIs10543 |
Lineage Allele |
stIs10024;zuIs178 |
Reporter Construct |
pJIM20::ceh-41 |
Created By |
EAP/DKV/JIM |
return to top of series: SERIES
|
Construct details:
Plasmid Name |
pJIM20::ceh-41 |
Gene |
ceh-41 |
Transcript |
T26C11.5 |
Promoter Length |
2432 |
Left Primer |
ttcttttcttcctaattggctcgtgaat |
Right Primer |
aacaaaatgctgggacatctgaaattatgataatgg |
Vector |
pJIM20 |
Integrated, Expressing Strains |
2 |
return to top of series: 20080808_ceh-41_2_L1
|
Full size movie:
return to top of series: 20080808_ceh-41_2_L1
|
Fullsize tree:
return to top of series: 20080808_ceh-41_2_L1
|
Download annotations for this experiment
return to top of series: 20080808_ceh-41_2_L1
|