 |
EPIC home
|
Show all experiments for hlh-16
|
Back to previous page
|
Details for experimental series: 20080812_hlh-16_12_L1; gene: hlh-16 |
experiment details |
strain details |
construct details |
full-size tree |
full-size movie |
download annotations for this experiment |
Experiment details:
Series |
20080812_hlh-16_12_L1 |
Date |
8/12/08 |
Person |
JIM |
Strain |
RW10588 |
Treatments |
None |
Gene Assayed |
hlh-16 |
Type of Construct |
Promoter Fusion |
Imaged Timepoints |
250 |
Edited Timepoints |
145 |
Edited Cells |
359 |
comments
|
ABpxpaaaa, ABalapp |
Edited By |
JIM |
return to top of series: 20080812_hlh-16_12_L1
|
Strain details:
Strain Name |
RW10588 |
Date Created |
8/25/08 |
Source of Genotype |
hlh-16::H1-Wcherry |
Reporter Allele |
stIs10544 |
Lineage Allele |
stIs10024;zuIs178 |
Reporter Construct |
pJIM20::hlh-16 |
Created By |
EAP/DKV/JIM |
return to top of series: SERIES
|
Construct details:
Plasmid Name |
pJIM20::hlh-16 |
Gene |
hlh-16 |
Transcript |
DY3.3 |
Promoter Length |
2459 |
Left Primer |
tgtgcagttgagtttgtgttctacgatt |
Right Primer |
cggtgattccgaagacataatcggaga |
Vector |
pJIM20 |
Integrated, Expressing Strains |
3 |
return to top of series: 20080812_hlh-16_12_L1
|
Full size movie:
return to top of series: 20080812_hlh-16_12_L1
|
Fullsize tree:
return to top of series: 20080812_hlh-16_12_L1
|
Download annotations for this experiment
return to top of series: 20080812_hlh-16_12_L1
|