20080819_nhr-171_16_L2

headersmall

EPIC home | Show all experiments for nhr-171 | Back to previous page

Details for experimental series: 20080819_nhr-171_16_L2; gene: nhr-171

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20080819_nhr-171_16_L2
Date	8/19/08
Person	JIM
Strain	RW10594
Treatments	None
Gene Assayed	nhr-171
Type of Construct	Promoter Fusion
Imaged Timepoints	238
Edited Timepoints	150
Edited Cells	368
comments	~all hyp
Edited By	JIM

return to top of series: 20080819_nhr-171_16_L2

Strain details:

Strain Name	RW10594
Date Created	8/25/08
Source of Genotype	nhr-171::H1-Wcherry
Reporter Allele	stIs10530
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::nhr-171
Created By	EAP/DKV/JIM

return to top of series: SERIES

Construct details:

Plasmid Name	pJIM20::nhr-171
Gene	nhr-171
Transcript	C54F6.8
Promoter Length	2277
Left Primer	ggggtttcaaagaaaaacggagtaaaat
Right Primer	tgtagctggtgtttgcatataatgataaatattgtcctaaa
Vector	pJIM20
Integrated, Expressing Strains	2

return to top of series: 20080819_nhr-171_16_L2

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20080819_nhr-171_16_L2

return to top of series: 20080819_nhr-171_16_L2

Download annotations for this experiment

return to top of series: 20080819_nhr-171_16_L2