 |
EPIC home
|
Show all experiments for tbx-37
|
Back to previous page
|
Details for experimental series: 20080912_tbx-37_b12_L1; gene: tbx-37 |
experiment details |
strain details |
construct details |
full-size tree |
full-size movie |
download annotations for this experiment |
Experiment details:
Series |
20080912_tbx-37_b12_L1 |
Date |
9/11/08 |
Person |
JIM |
Strain |
RW10705 |
Treatments |
None |
Gene Assayed |
tbx-37 |
Type of Construct |
Promoter Fusion |
Imaged Timepoints |
268 |
Edited Timepoints |
160 |
Edited Cells |
365 |
comments
|
ABa |
Edited By |
JIM |
return to top of series: 20080912_tbx-37_b12_L1
|
Strain details:
Strain Name |
RW10705 |
Date Created |
9/27/08 |
Source of Genotype |
tbx-37::H1-Wcherry |
Reporter Allele |
stIs10499 |
Lineage Allele |
stIs10024;zuIs178 |
Reporter Construct |
pJIM20::tbx-37 |
Created By |
EAP/DKV/JIM |
return to top of series: SERIES
|
Construct details:
Plasmid Name |
pJIM20::tbx-37 |
Gene |
tbx-37 |
Transcript |
Y47D3A.12 |
Promoter Length |
2432 |
Left Primer |
aaattcaccgcacacctttaataagtcc |
Right Primer |
acatacatatgaacgcatgggggc |
Vector |
pJIM20 |
Integrated, Expressing Strains |
1 |
return to top of series: 20080912_tbx-37_b12_L1
|
Full size movie:
return to top of series: 20080912_tbx-37_b12_L1
|
Fullsize tree:
return to top of series: 20080912_tbx-37_b12_L1
|
Download annotations for this experiment
return to top of series: 20080912_tbx-37_b12_L1
|