 |
|
EPIC home
|
Show all experiments for moe-3
|
Back to previous page
|
| Details for experimental series: 20081002_moe-3_8_L1; gene: moe-3 |
| experiment details |
strain details |
construct details |
full-size tree |
full-size movie |
download annotations for this experiment |
Experiment details:
Series |
20081002_moe-3_8_L1 |
Date |
10/1/08 |
Person |
JIM |
Strain |
RW10734 |
Treatments |
None |
Gene Assayed |
moe-3 |
Type of Construct |
Promoter Fusion |
Imaged Timepoints |
246 |
Edited Timepoints |
150 |
Edited Cells |
353 |
comments
|
Ca subset, asymmetric in AB |
Edited By |
JIM |
return to top of series: 20081002_moe-3_8_L1
|
Strain details:
Strain Name |
RW10734 |
Date Created |
10/13/08 |
Source of Genotype |
moe-3::H1-Wcherry |
Reporter Allele |
stIs10700 |
Lineage Allele |
stIs10024;zuIs178 |
Reporter Construct |
pJIM20::moe-3 |
Created By |
EAP/DKV/JIM |
return to top of series: SERIES
|
Construct details:
Plasmid Name |
pJIM20::moe-3 |
Gene |
moe-3 |
Transcript |
F32A11.6 |
Promoter Length |
5095 |
Left Primer |
gcgtccgttgtcattagattttacatgt |
Right Primer |
ccctttcaccttgctcatcgtgc |
Vector |
pJIM20 |
Integrated, Expressing Strains |
1 |
return to top of series: 20081002_moe-3_8_L1
|
Full size movie:
return to top of series: 20081002_moe-3_8_L1
|
Fullsize tree:
return to top of series: 20081002_moe-3_8_L1
|
Download annotations for this experiment
return to top of series: 20081002_moe-3_8_L1
|