 |
EPIC home
|
Show all experiments for sma-9
|
Back to previous page
|
Details for experimental series: 20081003_sma-9k_1_L2; gene: sma-9 |
experiment details |
strain details |
construct details |
full-size tree |
full-size movie |
download annotations for this experiment |
Experiment details:
Series |
20081003_sma-9k_1_L2 |
Date |
10/3/08 |
Person |
JIM |
Strain |
RW10745 |
Treatments |
None |
Gene Assayed |
sma-9 |
Type of Construct |
Promoter Fusion |
Imaged Timepoints |
274 |
Edited Timepoints |
160 |
Edited Cells |
357 |
comments
|
hyp-biased ubiq (bias best after 350 cells) |
Edited By |
JIM |
return to top of series: 20081003_sma-9k_1_L2
|
Strain details:
Strain Name |
RW10745 |
Date Created |
10/27/08 |
Source of Genotype |
sma-9k::H1-Wcherry |
Reporter Allele |
stIs10698 |
Lineage Allele |
stIs10024;zuIs178 |
Reporter Construct |
pJIM20::sma-9k |
Created By |
EAP/DKV/JIM |
return to top of series: SERIES
|
Construct details:
Plasmid Name |
pJIM20::sma-9k |
Gene |
sma-9k |
Transcript |
T05A10.1k |
Promoter Length |
5410 |
Left Primer |
ttgcatttagacatcattcctgttgatg |
Right Primer |
acccggagcaaatgccattggaggc |
Vector |
pJIM20 |
Integrated, Expressing Strains |
3 |
return to top of series: 20081003_sma-9k_1_L2
|
Full size movie:
return to top of series: 20081003_sma-9k_1_L2
|
Fullsize tree:
return to top of series: 20081003_sma-9k_1_L2
|
Download annotations for this experiment
return to top of series: 20081003_sma-9k_1_L2
|