 |
EPIC home
|
Show all experiments for ref-1
|
Back to previous page
|
Details for experimental series: 20081014_ref-1_2_L1; gene: ref-1 |
experiment details |
strain details |
construct details |
full-size tree |
full-size movie |
download annotations for this experiment |
Experiment details:
Series |
20081014_ref-1_2_L1 |
Date |
10/15/08 |
Person |
JIM |
Strain |
RW10752 |
Treatments |
None |
Gene Assayed |
ref-1 |
Type of Construct |
Promoter Fusion |
Imaged Timepoints |
263 |
Edited Timepoints |
160 |
Edited Cells |
401 |
comments
|
big jumps starting around t120 |
Edited By |
JIM |
return to top of series: 20081014_ref-1_2_L1
|
Strain details:
Strain Name |
RW10752 |
Date Created |
10/27/08 |
Source of Genotype |
ref-1::H1-Wcherry |
Reporter Allele |
stIs10691 |
Lineage Allele |
stIs10024;zuIs178 |
Reporter Construct |
pJIM20::ref-1 |
Created By |
EAP/DKV/JIM |
return to top of series: SERIES
|
Construct details:
Plasmid Name |
pJIM20::ref-1 |
Gene |
ref-1 |
Transcript |
T01E8.2 |
Promoter Length |
5157 |
Left Primer |
tgatgggaaaaaattggaaaaacataca |
Right Primer |
ggtactgatgaggaccatttctggaaaaaaaattaagtttt |
Vector |
pJIM20 |
Integrated, Expressing Strains |
1 |
return to top of series: 20081014_ref-1_2_L1
|
Full size movie:
return to top of series: 20081014_ref-1_2_L1
|
Fullsize tree:
return to top of series: 20081014_ref-1_2_L1
|
Download annotations for this experiment
return to top of series: 20081014_ref-1_2_L1
|