20081014_ref-1_2_L2

headersmall

EPIC home | Show all experiments for ref-1 | Back to previous page

Details for experimental series: 20081014_ref-1_2_L2; gene: ref-1

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20081014_ref-1_2_L2
Date	10/15/08
Person	JIM
Strain	RW10752
Treatments	None
Gene Assayed	ref-1
Type of Construct	Promoter Fusion
Imaged Timepoints	263
Edited Timepoints	150
Edited Cells	369
comments	PVL; notch-signaled lineages, others
Edited By	JIM

return to top of series: 20081014_ref-1_2_L2

Strain details:

Strain Name	RW10752
Date Created	10/27/08
Source of Genotype	ref-1::H1-Wcherry
Reporter Allele	stIs10691
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::ref-1
Created By	EAP/DKV/JIM

return to top of series: SERIES

Construct details:

Plasmid Name	pJIM20::ref-1
Gene	ref-1
Transcript	T01E8.2
Promoter Length	5157
Left Primer	tgatgggaaaaaattggaaaaacataca
Right Primer	ggtactgatgaggaccatttctggaaaaaaaattaagtttt
Vector	pJIM20
Integrated, Expressing Strains	1

return to top of series: 20081014_ref-1_2_L2

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20081014_ref-1_2_L2

return to top of series: 20081014_ref-1_2_L2

Download annotations for this experiment

return to top of series: 20081014_ref-1_2_L2