 |
|
EPIC home
|
Show all experiments for pax-3
|
Back to previous page
|
| Details for experimental series: 20081022_pax-3_1_L1; gene: pax-3 |
| experiment details |
strain details |
construct details |
full-size tree |
full-size movie |
download annotations for this experiment |
Experiment details:
Series |
20081022_pax-3_1_L1 |
Date |
10/22/08 |
Person |
JIM |
Strain |
RW10744 |
Treatments |
None |
Gene Assayed |
pax-3 |
Type of Construct |
Promoter Fusion |
Imaged Timepoints |
259 |
Edited Timepoints |
150 |
Edited Cells |
364 |
comments
|
ABpxapp, ABpxaapp |
Edited By |
JIM |
return to top of series: 20081022_pax-3_1_L1
|
Strain details:
Strain Name |
RW10744 |
Date Created |
10/27/08 |
Source of Genotype |
pax-3::H1-Wcherry |
Reporter Allele |
stIs10644 |
Lineage Allele |
stIs10024;zuIs178 |
Reporter Construct |
pJIM20::pax-3 |
Created By |
EAP/DKV/JIM |
return to top of series: SERIES
|
Construct details:
Plasmid Name |
pJIM20::pax-3 |
Gene |
pax-3 |
Transcript |
F27E5.2 |
Promoter Length |
2616 |
Left Primer |
ttgtcggaagtggttgtactctctcttc |
Right Primer |
gatagaatctgtggtcattttgttagtagtggatgggatat |
Vector |
pJIM20 |
Integrated, Expressing Strains |
4 |
return to top of series: 20081022_pax-3_1_L1
|
Full size movie:
return to top of series: 20081022_pax-3_1_L1
|
Fullsize tree:
return to top of series: 20081022_pax-3_1_L1
|
Download annotations for this experiment
return to top of series: 20081022_pax-3_1_L1
|