20081028_T23H4_2_10_L1

headersmall

EPIC home | Show all experiments for T23H4.2 | Back to previous page

Details for experimental series: 20081028_T23H4_2_10_L1; gene: T23H4.2

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20081028_T23H4_2_10_L1
Date	10/28/08
Person	JIM
Strain	RW11052
Treatments	None
Gene Assayed	T23H4.2
Type of Construct	Promoter Fusion
Imaged Timepoints	274
Edited Timepoints	160
Edited Cells	351
comments	E, Chyp, D, ABhyp
Edited By	JIM

return to top of series: 20081028_T23H4_2_10_L1

Strain details:

Strain Name	RW11052
Date Created	n/a
Source of Genotype	T23H4.2::H1-Wcherry
Reporter Allele	stIs10658
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::T23H4.2
Created By	EAP/JIM/DKV

return to top of series: SERIES

Construct details:

Plasmid Name	pJIM20::T23H4.2
Gene	T23H4.2
Transcript	T23H4.2
Promoter Length	4644
Left Primer	aaccagaaaaaaagaatttcccacattg
Right Primer	acatatttcttcgaccatactttttgtctaaatatttatg
Vector	pJIM20
Integrated, Expressing Strains	3

return to top of series: 20081028_T23H4_2_10_L1

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20081028_T23H4_2_10_L1

return to top of series: 20081028_T23H4_2_10_L1

Download annotations for this experiment

return to top of series: 20081028_T23H4_2_10_L1