 |
EPIC home
|
Show all experiments for pes-1
|
Back to previous page
|
Details for experimental series: 20081031_pes-1_7_L2; gene: pes-1 |
experiment details |
strain details |
construct details |
full-size tree |
full-size movie |
download annotations for this experiment |
Experiment details:
Series |
20081031_pes-1_7_L2 |
Date |
10/31/08 |
Person |
JIM |
Strain |
RW10765 |
Treatments |
None |
Gene Assayed |
pes-1 |
Type of Construct |
Promoter Fusion |
Imaged Timepoints |
250 |
Edited Timepoints |
145 |
Edited Cells |
362 |
comments
|
asymmetric patterns in most lineages |
Edited By |
JIM |
return to top of series: 20081031_pes-1_7_L2
|
Strain details:
Strain Name |
RW10765 |
Date Created |
11/14/08 |
Source of Genotype |
pes-1::H1-Wcherry |
Reporter Allele |
stIs10622 |
Lineage Allele |
stIs10024;zuIs178 |
Reporter Construct |
pJIM20::pes-1 |
Created By |
EAP/DKV/JIM |
return to top of series: SERIES
|
Construct details:
Plasmid Name |
pJIM20::pes-1 |
Gene |
pes-1 |
Transcript |
T28H11.4 |
Promoter Length |
2937 |
Left Primer |
tgattttattacggctttcgccaaatat |
Right Primer |
tttgattgatgacgtcatctaaatgtattattatgtagtag |
Vector |
pJIM20 |
Integrated, Expressing Strains |
1 |
return to top of series: 20081031_pes-1_7_L2
|
Full size movie:
return to top of series: 20081031_pes-1_7_L2
|
Fullsize tree:
return to top of series: 20081031_pes-1_7_L2
|
Download annotations for this experiment
return to top of series: 20081031_pes-1_7_L2
|