 |
EPIC home
|
Show all experiments for nhr-68
|
Back to previous page
|
Details for experimental series: 20090312_nhr-68_13_L2; gene: nhr-68 |
experiment details |
strain details |
construct details |
full-size tree |
full-size movie |
download annotations for this experiment |
Experiment details:
Series |
20090312_nhr-68_13_L2 |
Date |
3/12/09 |
Person |
JIM |
Strain |
RW10849 |
Treatments |
None |
Gene Assayed |
nhr-68 |
Type of Construct |
Promoter Fusion |
Imaged Timepoints |
279 |
Edited Timepoints |
155 |
Edited Cells |
360 |
comments
|
gut/hyp |
Edited By |
JIM |
return to top of series: 20090312_nhr-68_13_L2
|
Strain details:
Strain Name |
RW10849 |
Date Created |
2/23/09 |
Source of Genotype |
nhr-68::H1-Wcherry |
Reporter Allele |
stIs10508 |
Lineage Allele |
stIs10024;zuIs178 |
Reporter Construct |
pJIM20::nhr-68 |
Created By |
EAP/DKV/JIM |
return to top of series: SERIES
|
Construct details:
Plasmid Name |
pJIM20::nhr-68 |
Gene |
nhr-68 |
Transcript |
H12C20.3 |
Promoter Length |
2352 |
Left Primer |
tcaaaaagcatttgaaacatattggagc |
Right Primer |
aacctctttgttctccattgacggaggattagaaccg |
Vector |
pJIM20 |
Integrated, Expressing Strains |
3 |
return to top of series: 20090312_nhr-68_13_L2
|
Full size movie:
return to top of series: 20090312_nhr-68_13_L2
|
Fullsize tree:
return to top of series: 20090312_nhr-68_13_L2
|
Download annotations for this experiment
return to top of series: 20090312_nhr-68_13_L2
|