20090428_T23H4_2_2_L1

headersmall

EPIC home | Show all experiments for T23H4.2 | Back to previous page

Details for experimental series: 20090428_T23H4_2_2_L1; gene: T23H4.2

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20090428_T23H4_2_2_L1
Date	4/28/09
Person	JIM
Strain	RW10855
Treatments	None
Gene Assayed	T23H4.2
Type of Construct	Promoter Fusion
Imaged Timepoints	255
Edited Timepoints	145
Edited Cells	367
comments	gut + hyp
Edited By	JIM

return to top of series: 20090428_T23H4_2_2_L1

Strain details:

Strain Name	RW10855
Date Created	2/23/09
Source of Genotype	T23H4.2::H1-Wcherry
Reporter Allele	stIs10657
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::T23H4.2
Created By	EAP/DKV/JIM

return to top of series: SERIES

Construct details:

Plasmid Name	pJIM20::T23H4.2
Gene	T23H4.2
Transcript	T23H4.2
Promoter Length	4644
Left Primer	aaccagaaaaaaagaatttcccacattg
Right Primer	acatatttcttcgaccatactttttgtctaaatatttatg
Vector	pJIM20
Integrated, Expressing Strains	3

return to top of series: 20090428_T23H4_2_2_L1

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20090428_T23H4_2_2_L1

return to top of series: 20090428_T23H4_2_2_L1

Download annotations for this experiment

return to top of series: 20090428_T23H4_2_2_L1