 |
EPIC home
|
Show all experiments for T22C8.3
|
Back to previous page
|
Details for experimental series: 20091118_T22C8_3_11_L1; gene: T22C8.3 |
experiment details |
strain details |
construct details |
full-size tree |
full-size movie |
download annotations for this experiment |
Experiment details:
Series |
20091118_T22C8_3_11_L1 |
Date |
11/18/09 |
Person |
JIM |
Strain |
RW11142 |
Treatments |
None |
Gene Assayed |
T22C8.3 |
Type of Construct |
Promoter Fusion |
Imaged Timepoints |
259 |
Edited Timepoints |
140 |
Edited Cells |
363 |
comments
|
biased ubiq |
Edited By |
JIM |
return to top of series: 20091118_T22C8_3_11_L1
|
Strain details:
Strain Name |
RW11142 |
Date Created |
10/30/09 |
Source of Genotype |
T22C8.3::H1-Wcherry |
Reporter Allele |
stIs10526 |
Lineage Allele |
stIs10024;zuIs178 |
Reporter Construct |
pJIM20::T22C8.3 |
Created By |
EAP/DKV/JIM |
return to top of series: SERIES
|
Construct details:
Plasmid Name |
pJIM20::T22C8.3 |
Gene |
T22C8.3 |
Transcript |
T22C8.3 |
Promoter Length |
2059 |
Left Primer |
tattttgcttcctctatgacagttgcgt |
Right Primer |
ttgttcggtggttgccatgact |
Vector |
pJIM20 |
Integrated, Expressing Strains |
3 |
return to top of series: 20091118_T22C8_3_11_L1
|
Full size movie:
return to top of series: 20091118_T22C8_3_11_L1
|
Fullsize tree:
return to top of series: 20091118_T22C8_3_11_L1
|
Download annotations for this experiment
return to top of series: 20091118_T22C8_3_11_L1
|